|
Thermo Fisher
hplc-pda system ultramate 3000 series Hplc Pda System Ultramate 3000 Series, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hplc-pda system ultramate 3000 series/product/Thermo Fisher Average 90 stars, based on 1 article reviews
hplc-pda system ultramate 3000 series - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Osram Sylvania
ultramed fda ky10s 1000 w lamp Ultramed Fda Ky10s 1000 W Lamp, supplied by Osram Sylvania, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ultramed fda ky10s 1000 w lamp/product/Osram Sylvania Average 90 stars, based on 1 article reviews
ultramed fda ky10s 1000 w lamp - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
ultramer gtttaagagctaagctggaaacagcatagcaagtttaaataa example ultramer sequence Ultramer Gtttaagagctaagctggaaacagcatagcaagtttaaataa Example Ultramer Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ultramer gtttaagagctaagctggaaacagcatagcaagtttaaataa example ultramer sequence/product/Addgene inc Average 96 stars, based on 1 article reviews
ultramer gtttaagagctaagctggaaacagcatagcaagtttaaataa example ultramer sequence - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Danaher Inc
hundred base pair ultramers Hundred Base Pair Ultramers, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hundred base pair ultramers/product/Danaher Inc Average 86 stars, based on 1 article reviews
hundred base pair ultramers - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Ortho McNeil Pharmaceutical
ultram (tramadol) Ultram (Tramadol), supplied by Ortho McNeil Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ultram (tramadol)/product/Ortho McNeil Pharmaceutical Average 90 stars, based on 1 article reviews
ultram (tramadol) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
ultramers Ultramers, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ultramers/product/Danaher Inc Average 86 stars, based on 1 article reviews
ultramers - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Danaher Inc
ultramers idt Ultramers Idt, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ultramers idt/product/Danaher Inc Average 86 stars, based on 1 article reviews
ultramers idt - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Danaher Inc
page purified ultramer single stranded dna oligonucleotide Page Purified Ultramer Single Stranded Dna Oligonucleotide, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/page purified ultramer single stranded dna oligonucleotide/product/Danaher Inc Average 86 stars, based on 1 article reviews
page purified ultramer single stranded dna oligonucleotide - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Oligos Etc
ultramer dna oligos Ultramer Dna Oligos, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ultramer dna oligos/product/Oligos Etc Average 90 stars, based on 1 article reviews
ultramer dna oligos - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |